Review



oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa  (Biosearch Technologies Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Biosearch Technologies Inc oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa
    Oligonucleotides; Il6 Smfish Probes Gagaaggcaactggaccgaa, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/oligonucleotides++il6+smfish+probes+gagaaggcaactggaccgaa/pm39577413-234-90-95
    Average 90 stars, based on 1 article reviews
    oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Software:

    Article Title: Cell-Size-Dependent Transcription of FLC and Its Antisense Long Non-coding RNA COOLAIR Explain Cell-to-Cell Expression Variation
    Article Snippet: .. Caroline Dean laboratory, first described in (Csorba et al., 2014) N/A Oligonucleotides smFISH probes, see Table S1 Biosearch Technologies N/A Software and Algorithms Cellular RNA count and Z-projected cell area script Duncan et al., 2016; Olsson and Hartley, 2016 https://github.com/ri23/FISHmodel Cell volume estimation script This study https://github.com/ri23/FISHmodel Cellular mRNA production and degradation simulations This study https://github.com/ri23/FISHmodel FLC transcription and RNA processing simulations This study https://github.com/ri23/FISHmodel FISH-quant Mueller et al., 2013 https://code.google.com/archive/ p/fish-quant/ ..

    Fluorescence In Situ Hybridization:

    Article Title: Cell-Size-Dependent Transcription of FLC and Its Antisense Long Non-coding RNA COOLAIR Explain Cell-to-Cell Expression Variation
    Article Snippet: .. Caroline Dean laboratory, first described in (Csorba et al., 2014) N/A Oligonucleotides smFISH probes, see Table S1 Biosearch Technologies N/A Software and Algorithms Cellular RNA count and Z-projected cell area script Duncan et al., 2016; Olsson and Hartley, 2016 https://github.com/ri23/FISHmodel Cell volume estimation script This study https://github.com/ri23/FISHmodel Cellular mRNA production and degradation simulations This study https://github.com/ri23/FISHmodel FLC transcription and RNA processing simulations This study https://github.com/ri23/FISHmodel FISH-quant Mueller et al., 2013 https://code.google.com/archive/ p/fish-quant/ ..



    Similar Products

    oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa  (Biosearch Technologies Inc)
    90
    Biosearch Technologies Inc oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa
    Oligonucleotides; Il6 Smfish Probes Gagaaggcaactggaccgaa, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/oligonucleotides++il6+smfish+probes+gagaaggcaactggaccgaa/pm39577413-234-90-95
    Average 90 stars, based on 1 article reviews
    oligonucleotides; il6-smfish probes gagaaggcaactggaccgaa - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    c57bl 6jolahsd oligonucleotides smfish probes  (Envigo)
    96
    Envigo c57bl 6jolahsd oligonucleotides smfish probes
    C57bl 6jolahsd Oligonucleotides Smfish Probes, supplied by Envigo, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/C57BL%2F6+inbred+mice/pm35659879-285-58-56
    Average 96 stars, based on 1 article reviews
    c57bl 6jolahsd oligonucleotides smfish probes - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    smfish oligonucleotide probes  (Biosearch Technologies Inc)
    90
    Biosearch Technologies Inc smfish oligonucleotide probes

    Smfish Oligonucleotide Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/smfish+probes/pmc07340504-255-4-14
    Average 90 stars, based on 1 article reviews
    smfish oligonucleotide probes - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    smfish probe sets of 20-nucleotide oligonucleotides with 2-nucleotide spacing, complementary to gfp (32 oligos)  (Oligos Etc)
    90
    Oligos Etc smfish probe sets of 20-nucleotide oligonucleotides with 2-nucleotide spacing, complementary to gfp (32 oligos)

    Smfish Probe Sets Of 20 Nucleotide Oligonucleotides With 2 Nucleotide Spacing, Complementary To Gfp (32 Oligos), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/oligos+with+2++o+methylation/pmc06262787-427-11-14
    Average 90 stars, based on 1 article reviews
    smfish probe sets of 20-nucleotide oligonucleotides with 2-nucleotide spacing, complementary to gfp (32 oligos) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    smfish probes of 20 nt oligonucleotides with 2 nt spacing  (Biosearch Technologies Inc)
    90
    Biosearch Technologies Inc smfish probes of 20 nt oligonucleotides with 2 nt spacing

    Smfish Probes Of 20 Nt Oligonucleotides With 2 Nt Spacing, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/smfish+probes+20+nt+oligonucleotides+2+nt+spacing/pmc06008217-433-8-20
    Average 90 stars, based on 1 article reviews
    smfish probes of 20 nt oligonucleotides with 2 nt spacing - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    oligonucleotides smfish probes  (Biosearch Technologies Inc)
    90
    Biosearch Technologies Inc oligonucleotides smfish probes

    Oligonucleotides Smfish Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/oligonucleotides+smfish+probes/smfish+probes/pmc05493185__mmc3-314-9-17
    Average 90 stars, based on 1 article reviews
    oligonucleotides smfish probes - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: The Wg and Dpp morphogens regulate gene expression by modulating the frequency of transcriptional bursts

    doi: 10.7554/eLife.56076

    Figure Lengend Snippet:

    Article Snippet: smFISH Probe Design and Preparation smFISH oligonucleotide probes were designed using Stellaris Probe Designer (Biosearch Technologies).

    Techniques: Construct, Sequencing, Hybridization, Modification, Plasmid Preparation, Software, Organ Culture